Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA

Download Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA Ebook, Epub, Textbook, quickly and easily or read online Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA full books anytime and anywhere. Click download or read online button and get unlimited access by create free account.

Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA
Title Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA
Author
Publisher Pantheon
Release DateMarch 17, 2020
Category Science Fiction & Fantasy
Total Pages 224 pages
ISBN B07RYHNGZY
Book Rating 4.6 out of 5 from 254 reviews
Language EN, ES, BE, DA ,DE , NL and FR
Book Review & Summary:

he author of the best-selling Your Inner Fish gives us a lively and accessible account of the great transformations in the history of life on Earth--a new view of the evolution of human and animal life that explains how the incredible diversity of life on our planet came to be. Over billions of years, ancient fish evolved to walk on land, reptiles transformed into birds that fly, and apelike primates evolved into humans that walk on two legs, talk, and write. For more than a century, paleontologists have traveled the globe to find fossils that show how such changes have happened. We have now arrived at a remarkable moment—prehistoric fossils coupled with new DNA technology have given us the tools to answer some of the basic questions of our existence: How do big changes in evolution happen? Is our presence on Earth the product of mere chance? This new science reveals a multibillion-year evolutionary history filled with twists and turns, trial and error, accident and invention. In Some Assembly Required, Neil Shubin takes readers on a journey of discovery spanning centuries, as explorers and scientists seek to understand the origins of life's immense diversity.

Similar books related to " Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA " from our database.

Some Assembly Required by Neil Shubin

Title Some Assembly Required
Author Neil Shubin
Publisher Vintage
Release Date 2021-08-31
Category Science
Total Pages 288
ISBN 9781101972687
Language English, Spanish, and French
GET BOOK
Book Summary:

"[An] account of the great transformations in the history of life on Earth--a new view of the evolution of human and animal life that explains how the incredible diversity of life on our planet came to be"--

Some Assembly Required by Neil Shubin

Title Some Assembly Required
Author Neil Shubin
Publisher Vintage
Release Date 2021-08-31
Category Science
Total Pages 288
ISBN 9781101972687
Language English, Spanish, and French
GET BOOK
Book Summary:

"[An] account of the great transformations in the history of life on Earth--a new view of the evolution of human and animal life that explains how the incredible diversity of life on our planet came to be"--

Some Assembly Required by Neil Shubin

Title Some Assembly Required
Author Neil Shubin
Publisher Vintage
Release Date 2020-03-17
Category Science
Total Pages 288
ISBN 9781101871348
Language English, Spanish, and French
GET BOOK
Book Summary:

An exciting and accessible new view of the evolution of human and animal life on Earth. From the author of national bestseller, Your Inner Fish, this extraordinary journey of discovery spans centuries, as explorers and scientists seek to understand the origins of life's immense diversity. “Fossils, DNA, scientists with a penchant for suits of armor—what’s not to love?”—BBC Wildlife Magazine Over billions of years, ancient fish evolved to walk on land, reptiles transformed into birds that fly, and apelike primates evolved into humans that walk on two legs, talk, and write. For more than a century, paleontologists have traveled the globe to find fossils that show how such changes have happened. We have now arrived at a remarkable moment—prehistoric fossils coupled with new DNA technology have given us the tools to answer some of the basic questions of our existence: How do big changes in evolution happen? Is our presence on Earth the product of mere chance? This new science reveals a multibillion-year evolutionary history filled with twists and turns, trial and error, accident and invention. In Some Assembly Required, Neil Shubin takes readers on a journey of discovery spanning centuries, as explorers and scientists seek to understand the origins of life's immense diversity.

The Universe Within by Neil Shubin

Title The Universe Within
Author Neil Shubin
Publisher Vintage
Release Date 2013-01-08
Category Science
Total Pages 240
ISBN 9780307907868
Language English, Spanish, and French
GET BOOK
Book Summary:

From one of our finest and most popular science writers, the best-selling author of Your Inner Fish, comes the answer to a scientific mystery story as big as the world itself: How have astronomical events that took place millions of years ago created the unique qualities of the human species? In his last book, Neil Shubin delved into the amazing connections between human anatomy—our hands, our jaws—and the structures in the fish that first took over land 375 million years ago. Now, with his trademark clarity and exuberance, he takes an even more expansive approach to the question of why we are the way we are. Starting once again with fossils, Shubin turns his gaze skyward. He shows how the entirety of the universe's 14-billion-year history can be seen in our bodies. From our very molecular composition (a result of stellar events at the origin of our solar system), he makes clear, through the working of our eyes, how the evolution of the cosmos has had profound effects on the development of human life on earth.

Your Inner Fish by Neil Shubin

Title Your Inner Fish
Author Neil Shubin
Publisher Vintage
Release Date 2009
Category Science
Total Pages 237
ISBN 9780307277459
Language English, Spanish, and French
GET BOOK
Book Summary:

A fascinating chronicle of the evolution of humankind traces the genetic history of the organs of the human body, offering a revealing correlation between the distant past and present-day human anatomy and physiology, behavior, illness, and DNA. Reprint. 75,000 first printing.

Oxygen by Donald E. Canfield

Title Oxygen
Author Donald E. Canfield
Publisher Princeton University Press
Release Date 2015-12-01
Category Science
Total Pages 216
ISBN 9780691168364
Language English, Spanish, and French
GET BOOK
Book Summary:

The air we breathe is twenty-one percent oxygen, an amount higher than on any other known world. While we may take our air for granted, Earth was not always an oxygenated planet. How did it become this way? Donald Canfield—one of the world's leading authorities on geochemistry, earth history, and the early oceans—covers this vast history, emphasizing its relationship to the evolution of life and the evolving chemistry of the Earth. Canfield guides readers through the various lines of scientific evidence, considers some of the wrong turns and dead ends along the way, and highlights the scientists and researchers who have made key discoveries in the field. Showing how Earth’s atmosphere developed over time, Oxygen takes readers on a remarkable journey through the history of the oxygenation of our planet.

Why Are We Here by Bruce Brodie

Title Why Are We Here
Author Bruce Brodie
Publisher iUniverse
Release Date 2019-05-24
Category Science
Total Pages 446
ISBN 9781532067976
Language English, Spanish, and French
GET BOOK
Book Summary:

From the big bang, to the origin and evolution of intelligent life in a search for the meaning of human existence, Why are We Here?, by author Bruce Brodie, offers a look at evolution and the future of life on the planet. Through many years of research and study, Brodie addresses a host of questions: • How did chemistry come to life? • How did the release of oxygen by cyanobacteria change the natural history of life? • How did mass extinctions reset the clock and reshape the course of biological evolution? • Why are homo sapiens so dominant? • Why do humans build vast civilizations, while chimps, with whom we share more than 98 percent of our DNA, are confined to forests and experimental laboratories and zoos? • How will cultural and technological evolution, which have transcended the slow pace of biological evolution, shape the future of life on the planet? • Can we escape the many existential threats that hover over us? Why are We Here? offers a new perspective on how we think about the world, and our place and our purpose in the universe and the future of humanity. It presents a lasting sense of the amazing wonder and mystery of life.

Title Symphony in C Carbon and the Evolution of Almost Everything
Author Robert M. Hazen
Publisher W. W. Norton & Company
Release Date 2019-06-11
Category Science
Total Pages 288
ISBN 9780393609448
Language English, Spanish, and French
GET BOOK
Book Summary:

An enchanting biography of the most resonant—and most necessary—chemical element on Earth. Carbon is everywhere: in the paper of this book and the blood of our bodies. It’s with us from beginning to end, present in our baby clothes and coffin alike. We live on a carbon planet, and we are carbon life. No other element is so central to our well-being; yet, when missing or misaligned, carbon atoms can also bring about disease and even death. At once ubiquitous and mysterious, carbon holds the answers to some of humanity’s biggest questions. Where did Earth come from? What will ultimately become of it—and of us? With poetic storytelling, earth scientist Robert M. Hazen explores the universe to discover the past, present, and future of life’s most essential element. We’re not only “made of star stuff,” as Carl Sagan famously observed, but “Big Bang stuff,” too. Hazen reveals that carbon’s grand symphony began with a frenzied prelude shortly after the dawn of creation, bringing new attention to the tiny number of Big Bang–created carbon atoms that often get overlooked. In minutes, violently colliding protons and neutrons improbably formed the first carbon atoms, which can still be found within our bodies. His book then unfolds in four movements, building momentum as he explores carbon as the element of Earth, Air, Fire, and Water. He visits the famed volcanic crater Solfatara di Pozzuoli near Naples, where venting carbon dioxide and other noxious fumes condense into beautiful crystals. He climbs the cliffs of the Scottish Highlands and delves deep into the precious-metal mines of Namibia, journeying toward Earth’s mysterious core in search of undocumented carbon structures. Hazen often asks us to pause and consider carbon’s role in climate change and what we can do about it, for our lives and this element are inextricably intertwined. With prose that sparkles like a diamond, Symphony in C tells the story of carbon, in which we all have a part.

At The Water S Edge by Carl Zimmer

Title At the Water s Edge
Author Carl Zimmer
Publisher Simon and Schuster
Release Date 2014-08-26
Category Science
Total Pages 304
ISBN 9781476799742
Language English, Spanish, and French
GET BOOK
Book Summary:

Everybody Out of the Pond At the Water's Edge will change the way you think about your place in the world. The awesome journey of life's transformation from the first microbes 4 billion years ago to Homo sapiens today is an epic that we are only now beginning to grasp. Magnificent and bizarre, it is the story of how we got here, what we left behind, and what we brought with us. We all know about evolution, but it still seems absurd that our ancestors were fish. Darwin's idea of natural selection was the key to solving generation-to-generation evolution -- microevolution -- but it could only point us toward a complete explanation, still to come, of the engines of macroevolution, the transformation of body shapes across millions of years. Now, drawing on the latest fossil discoveries and breakthrough scientific analysis, Carl Zimmer reveals how macroevolution works. Escorting us along the trail of discovery up to the current dramatic research in paleontology, ecology, genetics, and embryology, Zimmer shows how scientists today are unveiling the secrets of life that biologists struggled with two centuries ago. In this book, you will find a dazzling, brash literary talent and a rigorous scientific sensibility gracefully brought together. Carl Zimmer provides a comprehensive, lucid, and authoritative answer to the mystery of how nature actually made itself.

Creation by Adam Rutherford

Title Creation
Author Adam Rutherford
Publisher Penguin UK
Release Date 2013-04-04
Category Science
Total Pages 272
ISBN 9780141970226
Language English, Spanish, and French
GET BOOK
Book Summary:

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The Dance Of Life by Magdalena Zernicka-Goetz

Title The Dance of Life
Author Magdalena Zernicka-Goetz
Publisher Basic Books
Release Date 2020-02-25
Category Science
Total Pages 304
ISBN 9781541699045
Language English, Spanish, and French
GET BOOK
Book Summary:

A renowned biologist's cutting-edge and unconventional examination of human reproduction and embryo research Scientists have long struggled to make pregnancy easier, safer, and more successful. In The Dance of Life, developmental and stem-cell biologist Magdalena Zernicka-Goetz takes us to the front lines of efforts to understand the creation of a human life. She has spent two decades unraveling the mysteries of development, as a simple fertilized egg becomes a complex human being of forty trillion cells. Zernicka-Goetz's work is both incredibly practical and astonishingly vast: her groundbreaking experiments with mouse, human, and artificial embryo models give hope to how more women can sustain viable pregnancies. Set at the intersection of science's greatest powers and humanity's greatest concern, The Dance of Life is a revelatory account of the future of fertility -- and life itself.

Title When the Earth Had Two Moons
Author Erik Asphaug
Publisher HarperCollins
Release Date 2019-10-29
Category Science
Total Pages 368
ISBN 9780062657947
Language English, Spanish, and French
GET BOOK
Book Summary:

An astonishing exploration of planet formation and the origins of life by one of the world’s most innovative planetary geologists. In 1959, the Soviet probe Luna 3 took the first photos of the far side of the moon. Even in their poor resolution, the images stunned scientists: the far side is an enormous mountainous expanse, not the vast lava-plains seen from Earth. Subsequent missions have confirmed this in much greater detail. How could this be, and what might it tell us about our own place in the universe? As it turns out, quite a lot. Fourteen billion years ago, the universe exploded into being, creating galaxies and stars. Planets formed out of the leftover dust and gas that coalesced into larger and larger bodies orbiting around each star. In a sort of heavenly survival of the fittest, planetary bodies smashed into each other until solar systems emerged. Curiously, instead of being relatively similar in terms of composition, the planets in our solar system, and the comets, asteroids, satellites and rings, are bewitchingly distinct. So, too, the halves of our moon. In When the Earth Had Two Moons, esteemed planetary geologist Erik Asphaug takes us on an exhilarating tour through the farthest reaches of time and our galaxy to find out why. Beautifully written and provocatively argued, When the Earth Had Two Moons is not only a mind-blowing astronomical tour but a profound inquiry into the nature of life here—and billions of miles from home.

Evolution by Donald R. Prothero

Title Evolution
Author Donald R. Prothero
Publisher Columbia University Press
Release Date 2017-08-22
Category Science
Total Pages 384
ISBN 9780231543163
Language English, Spanish, and French
GET BOOK
Book Summary:

Donald R. Prothero’s Evolution is an entertaining and rigorous history of the transitional forms and series found in the fossil record. Its engaging narrative of scientific discovery and well-grounded analysis has led to the book’s widespread adoption in courses that teach the nature and value of fossil evidence for evolution. Evolution tackles systematics and cladistics, rock dating, neo-Darwinism, and macroevolution. It includes extensive coverage of the primordial soup, invertebrate transitions, the development of the backbone, the reign of the dinosaurs, and the transformation from early hominid to modern human. The book also details the many alleged “missing links” in the fossil record, including some of the most recent discoveries that flesh out the fossil timeline and the evolutionary process. In this second edition, Prothero describes new transitional fossils from various periods, vividly depicting such bizarre creatures as the Odontochelys, or the “turtle on the half shell”; fossil snakes with legs; and the “Frogamander,” a new example of amphibian transition. Prothero’s discussion of intelligent design arguments includes more historical examples and careful examination of the “experiments” and observations that are exploited by creationists seeking to undermine sound science education. With new perspectives, Prothero reframes creationism as a case study in denialism and pseudoscience rather than a field with its own intellectual dynamism. The first edition was hailed as an exemplary exploration of the fossil evidence for evolution, and this second edition will be welcome in the libraries of scholars, teachers, and general readers who stand up for sound science in this post-truth era.

Bring Back The King by Helen Pilcher

Title Bring Back the King
Author Helen Pilcher
Publisher Bloomsbury Publishing
Release Date 2016-09-22
Category Nature
Total Pages 288
ISBN 9781472912282
Language English, Spanish, and French
GET BOOK
Book Summary:

If you could bring back just one animal from the past, what would you choose? It can be anyone or anything from history, from the King of the Dinosaurs, T. rex, to the King of Rock 'n' Roll, Elvis Presley, and beyond. De-extinction – the ability to bring extinct species back to life – is fast becoming reality. Around the globe, scientists are trying to de-extinct all manner of animals, including the woolly mammoth, the passenger pigeon and a bizarre species of flatulent frog. But de-extinction is more than just bringing back the dead. It's a science that can be used to save species, shape evolution and sculpt the future of life on our planet. In Bring Back the King, scientist and comedy writer Helen Pilcher goes on a quest to identify the perfect de-extinction candidate. Along the way, she asks if Elvis could be recreated from the DNA inside a pickled wart, investigates whether it's possible to raise a pet dodo, and considers the odds of a 21st century Neanderthal turning heads on public transport. Pondering the practicalities and the point of de-extinction, Bring Back the King is a witty and wry exploration of what is bound to become one of the hottest topics in conservation – if not in science as a whole – in the years to come. READ THIS BOOK – the King commands it.

Title Rabbits with Horns and Other Astounding Viruses
Author Carl Zimmer
Publisher University of Chicago Press
Release Date 2012-12-20
Category Science
Total Pages 32
ISBN 9780226048734
Language English, Spanish, and French
GET BOOK
Book Summary:

Viruses are the smallest living things known to science, yet they hold the entire planet in their sway. Rabbits with Horns and Other Astounding Viruses explores the bizarre places viruses dwell, and considers the often unexpected ways they influence our world. From agricultural production and crystal caves to rabbits with horns and cervical cancer, viruses are behind many of the wonders—some fascinating, some frightening—of the natural world, as well as some of our greatest medical challenges. Through his engaging considerations of the tobacco mosaic virus, viruses in ocean algae, and the human papillomavirus, award-winning science writer Carl Zimmer brings us up to speed on the nuances and depth of today's cutting-edge scientific research on virology.

Title Great Transformations in Vertebrate Evolution
Author Kenneth P. Dial
Publisher University of Chicago Press
Release Date 2015-07-20
Category Science
Total Pages 424
ISBN 9780226268392
Language English, Spanish, and French
GET BOOK
Book Summary:

How did flying birds evolve from running dinosaurs, terrestrial trotting tetrapods evolve from swimming fish, and whales return to swim in the sea? These are some of the great transformations in the 500-million-year history of vertebrate life. And with the aid of new techniques and approaches across a range of fields—work spanning multiple levels of biological organization from DNA sequences to organs and the physiology and ecology of whole organisms—we are now beginning to unravel the confounding evolutionary mysteries contained in the structure, genes, and fossil record of every living species. This book gathers a diverse team of renowned scientists to capture the excitement of these new discoveries in a collection that is both accessible to students and an important contribution to the future of its field. Marshaling a range of disciplines—from paleobiology to phylogenetics, developmental biology, ecology, and evolutionary biology—the contributors attack particular transformations in the head and neck, trunk, appendages such as fins and limbs, and the whole body, as well as offer synthetic perspectives. Illustrated throughout, Great Transformations in Vertebrate Evolution not only reveals the true origins of whales with legs, fish with elbows, wrists, and necks, and feathered dinosaurs, but also the relevance to our lives today of these extraordinary narratives of change.

Human Errors by Nathan H. Lents

Title Human Errors
Author Nathan H. Lents
Publisher Houghton Mifflin Harcourt
Release Date 2018-05-01
Category Science
Total Pages 256
ISBN 9781328974679
Language English, Spanish, and French
GET BOOK
Book Summary:

An illuminating, entertaining tour of the physical imperfections that make us human We humans like to think of ourselves as highly evolved creatures. But if we are supposedly evolution’s greatest creation, why do we have such bad knees? Why do we catch head colds so often—two hundred times more often than a dog does? How come our wrists have so many useless bones? Why is the vast majority of our genetic code pointless? And are we really supposed to swallow and breathe through the same narrow tube? Surely there’s been some kind of mistake. As professor of biology Nathan H. Lents explains in Human Errors, our evolutionary history is nothing if not a litany of mistakes, each more entertaining and enlightening than the last. The human body is one big pile of compromises. But that is also a testament to our greatness: as Lents shows, humans have so many design flaws precisely because we are very, very good at getting around them. A rollicking, deeply informative tour of humans’ four billion year long evolutionary saga, Human Errors both celebrates our imperfections and offers an unconventional accounting of the cost of our success.

What Is Life by Paul Nurse

Title What Is Life
Author Paul Nurse
Publisher David Fickling Books
Release Date 2020-09-03
Category Science
Total Pages 224
ISBN 9781788451413
Language English, Spanish, and French
GET BOOK
Book Summary:

‘A BEAUTIFULLY WRITTEN EXPLORATION OF PERHAPS THE MOST IMPORTANT QUESTION IN SCIENCE.’ BRIAN COX Life is all around us, abundant and diverse, it is extraordinary. But what does it actually mean to be alive? Nobel prize-winner Paul Nurse has spent his career revealing how living cells work. In this book, he takes up the challenge of defining life in a way that every reader can understand. It is a shared journey of discovery; step by step he illuminates five great ideas that underpin biology. He traces the roots of his own curiosity and knowledge to reveal how science works, both now and in the past. Using his personal experiences, in and out of the lab, he shares with us the challenges, the lucky breaks, and the thrilling eureka moments of discovery. To survive the challenges that face the human race today – from climate change, to pandemics, loss of biodiversity and food security – it is vital that we all understand what life is.

Never Home Alone by Rob Dunn

Title Never Home Alone
Author Rob Dunn
Publisher Basic Books
Release Date 2018-11-06
Category Science
Total Pages 336
ISBN 9781541645745
Language English, Spanish, and French
GET BOOK
Book Summary:

A natural history of the wilderness in our homes, from the microbes in our showers to the crickets in our basements Even when the floors are sparkling clean and the house seems silent, our domestic domain is wild beyond imagination. In Never Home Alone, biologist Rob Dunn introduces us to the nearly 200,000 species living with us in our own homes, from the Egyptian meal moths in our cupboards and camel crickets in our basements to the lactobacillus lounging on our kitchen counters. You are not alone. Yet, as we obsess over sterilizing our homes and separating our spaces from nature, we are unwittingly cultivating an entirely new playground for evolution. These changes are reshaping the organisms that live with us -- prompting some to become more dangerous, while undermining those species that benefit our bodies or help us keep more threatening organisms at bay. No one who reads this engrossing, revelatory book will look at their homes in the same way again.

Not A Chimp by Jeremy Taylor

Title Not a Chimp
Author Jeremy Taylor
Publisher OUP Oxford
Release Date 2010-05-27
Category Science
Total Pages 368
ISBN 9780191613586
Language English, Spanish, and French
GET BOOK
Book Summary:

Humans are primates, and our closest relatives are the other African apes - chimpanzees closest of all. With the mapping of the human genome, and that of the chimp, a direct comparison of the differences between the two, letter by letter along the billions of As, Gs, Cs, and Ts of the DNA code, has led to the widely vaunted claim that we differ from chimps by a mere 1.6% of our genetic code. A mere hair's breadth genetically! To a rather older tradition of anthropomorphizing chimps, trying to get them to speak, dressing them up for 'tea parties', was added the stamp of genetic confirmation. It also began an international race to find that handful of genes that make up the difference - the genes that make us uniquely human. But what does that 1.6% really mean? And should it really lead us to consider extending limited human rights to chimps, as some have suggested? Are we, after all, just chimps with a few genetic tweaks? Is our language and our technology just an extension of the grunts and ant-collecting sticks of chimps? In this book, Jeremy Taylor sketches the picture that is emerging from cutting edge research in genetics, animal behaviour, and other fields. The indications are that the so-called 1.6% is much larger and leads to profound differences between the two species. We shared a common ancestor with chimps some 6-7 million years ago, but we humans have been racing away ever since. One in ten of our genes, says Taylor, has undergone evolution in the past 40,000 years! Some of the changes that happened since we split from chimpanzees are to genes that control the way whole orchestras of other genes are switched on and off, and where. Taylor shows, using studies of certain genes now associated with speech and with brain development and activity, that the story looks to be much more complicated than we first thought. This rapidly changing and exciting field has recently discovered a host of genetic mechanisms that make us different from other apes. As Taylor points out, for too long we have let our sentimentality for chimps get in the way of our understanding. Chimps use tools, but so do crows. Certainly chimps are our closest genetic relatives. But relatively small differences in genetic code can lead to profound differences in cognition and behaviour. Our abilities give us the responsibility to protect and preserve the natural world, including endangered primates. But for the purposes of human society and human concepts such as rights, let's not pretend that chimps are humans uneducated and undressed. We've changed a lot in those 12 million years.

Metazoa by Peter Godfrey-Smith

Title Metazoa
Author Peter Godfrey-Smith
Publisher Farrar, Straus and Giroux
Release Date 2020-11-10
Category Science
Total Pages 352
ISBN 9780374720186
Language English, Spanish, and French
GET BOOK
Book Summary:

"Enthralling . . . breathtaking . . . Metazoa brings an extraordinary and astute look at our own mind’s essential link to the animal world." —The New York Times Book Review (Editors' Choice) "A great book . . . [Godfrey-Smith is] brilliant at describing just what he sees, the patterns of behaviour of the animals he observes." —Nigel Warburton, Five Books The scuba-diving philosopher who wrote Other Minds explores the origins of animal consciousness Dip below the ocean’s surface and you are soon confronted by forms of life that could not seem more foreign to our own: sea sponges, soft corals, and serpulid worms, whose rooted bodies, intricate geometry, and flower-like appendages are more reminiscent of plant life or even architecture than anything recognizably animal. Yet these creatures are our cousins. As fellow members of the animal kingdom—the Metazoa—they can teach us much about the evolutionary origins of not only our bodies, but also our minds. In his acclaimed 2016 book, Other Minds, the philosopher and scuba diver Peter Godfrey-Smith explored the mind of the octopus—the closest thing to an intelligent alien on Earth. In Metazoa, Godfrey-Smith expands his inquiry to animals at large, investigating the evolution of subjective experience with the assistance of far-flung species. As he delves into what it feels like to perceive and interact with the world as other life-forms do, Godfrey-Smith shows that the appearance of the animal body well over half a billion years ago was a profound innovation that set life upon a new path. In accessible, riveting prose, he charts the ways that subsequent evolutionary developments—eyes that track, for example, and bodies that move through and manipulate the environment—shaped the subjective lives of animals. Following the evolutionary paths of a glass sponge, soft coral, banded shrimp, octopus, and fish, then moving onto land and the world of insects, birds, and primates like ourselves, Metazoa gathers their stories together in a way that bridges the gap between mind and matter, addressing one of the most vexing philosophical problems: that of consciousness. Combining vivid animal encounters with philosophical reflections and the latest news from biology, Metazoa reveals that even in our high-tech, AI-driven times, there is no understanding our minds without understanding nerves, muscles, and active bodies. The story that results is as rich and vibrant as life itself.

LEAVE A COMMENT