Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA

Download Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA Ebook, Epub, Textbook, quickly and easily or read online Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA full books anytime and anywhere. Click download or read online button and get unlimited access by create free account.

Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA
Title Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA
Author
Publisher Pantheon
Release DateMarch 17, 2020
Category Science Fiction & Fantasy
Total Pages 224 pages
ISBN B07RYHNGZY
Book Rating 4.6 out of 5 from 254 reviews
Language EN, ES, BE, DA ,DE , NL and FR
Book Review & Summary:

he author of the best-selling Your Inner Fish gives us a lively and accessible account of the great transformations in the history of life on Earth--a new view of the evolution of human and animal life that explains how the incredible diversity of life on our planet came to be. Over billions of years, ancient fish evolved to walk on land, reptiles transformed into birds that fly, and apelike primates evolved into humans that walk on two legs, talk, and write. For more than a century, paleontologists have traveled the globe to find fossils that show how such changes have happened. We have now arrived at a remarkable moment—prehistoric fossils coupled with new DNA technology have given us the tools to answer some of the basic questions of our existence: How do big changes in evolution happen? Is our presence on Earth the product of mere chance? This new science reveals a multibillion-year evolutionary history filled with twists and turns, trial and error, accident and invention. In Some Assembly Required, Neil Shubin takes readers on a journey of discovery spanning centuries, as explorers and scientists seek to understand the origins of life's immense diversity.

Similar books related to " Some Assembly Required: Decoding Four Billion Years of Life, from Ancient Fossils to DNA " from our database.

Some Assembly Required by Neil Shubin

Title Some Assembly Required
Author Neil Shubin
Publisher Pantheon
Release Date 2020-03-17
Category Science
Total Pages 288
ISBN 9781101871348
Language English, Spanish, and French
GET BOOK
Book Summary:

The author of the best-selling Your Inner Fish gives us a lively and accessible account of the great transformations in the history of life on Earth--a new view of the evolution of human and animal life that explains how the incredible diversity of life on our planet came to be. Over billions of years, ancient fish evolved to walk on land, reptiles transformed into birds that fly, and apelike primates evolved into humans that walk on two legs, talk, and write. For more than a century, paleontologists have traveled the globe to find fossils that show how such changes have happened. We have now arrived at a remarkable moment—prehistoric fossils coupled with new DNA technology have given us the tools to answer some of the basic questions of our existence: How do big changes in evolution happen? Is our presence on Earth the product of mere chance? This new science reveals a multibillion-year evolutionary history filled with twists and turns, trial and error, accident and invention. In Some Assembly Required, Neil Shubin takes readers on a journey of discovery spanning centuries, as explorers and scientists seek to understand the origins of life's immense diversity.

The Universe Within by Neil Shubin

Title The Universe Within
Author Neil Shubin
Publisher Vintage
Release Date 2013-01-08
Category Science
Total Pages 240
ISBN 9780307907868
Language English, Spanish, and French
GET BOOK
Book Summary:

From one of our finest and most popular science writers, the best-selling author of Your Inner Fish, comes the answer to a scientific mystery story as big as the world itself: How have astronomical events that took place millions of years ago created the unique qualities of the human species? In his last book, Neil Shubin delved into the amazing connections between human anatomy—our hands, our jaws—and the structures in the fish that first took over land 375 million years ago. Now, with his trademark clarity and exuberance, he takes an even more expansive approach to the question of why we are the way we are. Starting once again with fossils, Shubin turns his gaze skyward. He shows how the entirety of the universe's 14-billion-year history can be seen in our bodies. From our very molecular composition (a result of stellar events at the origin of our solar system), he makes clear, through the working of our eyes, how the evolution of the cosmos has had profound effects on the development of human life on earth.

The Tangled Tree by David Quammen

Title The Tangled Tree
Author David Quammen
Publisher Simon & Schuster
Release Date 2019-08-06
Category Science
Total Pages 480
ISBN 9781476776637
Language English, Spanish, and French
GET BOOK
Book Summary:

In this New York Times bestseller and longlist nominee for the National Book Award, “our greatest living chronicler of the natural world” (The New York Times), David Quammen explains how recent discoveries in molecular biology affect our understanding of evolution and life’s history. In the mid-1970s, scientists began using DNA sequences to reexamine the history of all life. Perhaps the most startling discovery to come out of this new field—the study of life’s diversity and relatedness at the molecular level—is horizontal gene transfer (HGT), or the movement of genes across species lines. It turns out that HGT has been widespread and important; we now know that roughly eight percent of the human genome arrived sideways by viral infection—a type of HGT. In The Tangled Tree, “the grandest tale in biology….David Quammen presents the science—and the scientists involved—with patience, candor, and flair” (Nature). We learn about the major players, such as Carl Woese, the most important little-known biologist of the twentieth century; Lynn Margulis, the notorious maverick whose wild ideas about “mosaic” creatures proved to be true; and Tsutomu Wantanabe, who discovered that the scourge of antibiotic-resistant bacteria is a direct result of horizontal gene transfer, bringing the deep study of genome histories to bear on a global crisis in public health. “David Quammen proves to be an immensely well-informed guide to a complex story” (The Wall Street Journal). In The Tangled Tree, he explains how molecular studies of evolution have brought startling recognitions about the tangled tree of life—including where we humans fit upon it. Thanks to new technologies, we now have the ability to alter even our genetic composition—through sideways insertions, as nature has long been doing. “The Tangled Tree is a source of wonder….Quammen has written a deep and daring intellectual adventure” (The Boston Globe).

Your Inner Fish by Neil Shubin

Title Your Inner Fish
Author Neil Shubin
Publisher Vintage
Release Date 2009
Category Science
Total Pages 237
ISBN 9780307277459
Language English, Spanish, and French
GET BOOK
Book Summary:

A fascinating chronicle of the evolution of humankind traces the genetic history of the organs of the human body, offering a revealing correlation between the distant past and present-day human anatomy and physiology, behavior, illness, and DNA. Reprint. 75,000 first printing.

Footprints by David Farrier

Title Footprints
Author David Farrier
Publisher Farrar, Straus and Giroux
Release Date 2020-03-03
Category Nature
Total Pages 320
ISBN 9780374718992
Language English, Spanish, and French
GET BOOK
Book Summary:

A profound meditation on climate change and the Anthropocene and an urgent search for the fossils—industrial, chemical, geological—that humans are leaving behind What will the world look like in ten thousand years—or ten million? What kinds of stories will be told about us? In Footprints: In Search of Future Fossils, the award-winning author David Farrier explores the traces we will leave for the very distant future. Modern civilization has created objects and landscapes with the potential to endure through deep time, whether it is plastic polluting the oceans and nuclear waste sealed within the earth or the 30 million miles of roads spanning the planet. Our carbon could linger in the atmosphere for 100,000 years, and the remains of our cities will still exist millions of years from now as a layer in the rock. These future fossils have the potential to reveal much about how we lived in the twenty-first century. Crossing the boundaries of literature, art, and science, Footprints invites us to think about how we will be remembered in the myths and stories of our distant descendants. Traveling from the Baltic Sea to the Great Barrier Reef, and from an ice-core laboratory in Tasmania to Shanghai, one of the world’s biggest cities, Farrier describes a world that is changing rapidly, with consequences beyond the scope of human understanding. As much a message of hope as a warning, Footprints will not only alter how you think about the future; it will change how you see the world today.

Oxygen by Donald E. Canfield

Title Oxygen
Author Donald E. Canfield
Publisher Princeton University Press
Release Date 2015-12-01
Category Science
Total Pages 216
ISBN 9780691168364
Language English, Spanish, and French
GET BOOK
Book Summary:

The air we breathe is twenty-one percent oxygen, an amount higher than on any other known world. While we may take our air for granted, Earth was not always an oxygenated planet. How did it become this way? Donald Canfield—one of the world's leading authorities on geochemistry, earth history, and the early oceans—covers this vast history, emphasizing its relationship to the evolution of life and the evolving chemistry of the Earth. Canfield guides readers through the various lines of scientific evidence, considers some of the wrong turns and dead ends along the way, and highlights the scientists and researchers who have made key discoveries in the field. Showing how Earth’s atmosphere developed over time, Oxygen takes readers on a remarkable journey through the history of the oxygenation of our planet.

Brave Genius by Sean B. Carroll

Title Brave Genius
Author Sean B. Carroll
Publisher Broadway Books
Release Date 2013
Category Biography & Autobiography
Total Pages 581
ISBN 9780307952349
Language English, Spanish, and French
GET BOOK
Book Summary:

Traces the friendship and collaborative achievements of 20th-century intellectuals Albert Camus and Jacques Monod, discussing their contributions to the French Resistance, Nobel Prize-winning work and passionate advocacy of human rights.

Life by Richard Fortey

Title Life
Author Richard Fortey
Publisher Vintage
Release Date 2011-03-23
Category Science
Total Pages 400
ISBN 9780307761187
Language English, Spanish, and French
GET BOOK
Book Summary:

By one of Britain's most gifted scientists: a magnificently daring and compulsively readable account of life on Earth (from the "big bang" to the advent of man), based entirely on the most original of all sources--the evidence of fossils. With excitement and driving intelligence, Richard Fortey guides us from the barren globe spinning in space, through the very earliest signs of life in the sulphurous hot springs and volcanic vents of the young planet, the appearance of cells, the slow creation of an atmosphere and the evolution of myriad forms of plants and animals that could then be sustained, including the magnificent era of the dinosaurs, and on to the last moment before the debut of Homo sapiens. Ranging across multiple scientific disciplines, explicating in wonderfully clear and refreshing prose their findings and arguments--about the origins of life, the causes of species extinctions and the first appearance of man--Fortey weaves this history out of the most delicate traceries left in rock, stone and earth. He also explains how, on each aspect of nature and life, scientists have reached the understanding we have today, who made the key discoveries, who their opponents were and why certain ideas won. Brimful of wit, fascinating personal experience and high scholarship, this book may well be our best introduction yet to the complex history of life on Earth. A Book-of-the-Month Club Main Selection With 32 pages of photographs

Title Symphony in C Carbon and the Evolution of Almost Everything
Author Robert M. Hazen
Publisher W. W. Norton & Company
Release Date 2019-06-11
Category Science
Total Pages 288
ISBN 9780393609448
Language English, Spanish, and French
GET BOOK
Book Summary:

An enchanting biography of the most resonant—and most necessary—chemical element on Earth. Carbon is everywhere: in the paper of this book and the blood of our bodies. It’s with us from beginning to end, present in our baby clothes and coffin alike. We live on a carbon planet, and we are carbon life. No other element is so central to our well-being; yet, when missing or misaligned, carbon atoms can also bring about disease and even death. At once ubiquitous and mysterious, carbon holds the answers to some of humanity’s biggest questions. Where did Earth come from? What will ultimately become of it—and of us? With poetic storytelling, earth scientist Robert M. Hazen explores the universe to discover the past, present, and future of life’s most essential element. We’re not only “made of star stuff,” as Carl Sagan famously observed, but “Big Bang stuff,” too. Hazen reveals that carbon’s grand symphony began with a frenzied prelude shortly after the dawn of creation, bringing new attention to the tiny number of Big Bang–created carbon atoms that often get overlooked. In minutes, violently colliding protons and neutrons improbably formed the first carbon atoms, which can still be found within our bodies. His book then unfolds in four movements, building momentum as he explores carbon as the element of Earth, Air, Fire, and Water. He visits the famed volcanic crater Solfatara di Pozzuoli near Naples, where venting carbon dioxide and other noxious fumes condense into beautiful crystals. He climbs the cliffs of the Scottish Highlands and delves deep into the precious-metal mines of Namibia, journeying toward Earth’s mysterious core in search of undocumented carbon structures. Hazen often asks us to pause and consider carbon’s role in climate change and what we can do about it, for our lives and this element are inextricably intertwined. With prose that sparkles like a diamond, Symphony in C tells the story of carbon, in which we all have a part.

Title What Is Life Five Great Ideas in Biology
Author Paul Nurse
Publisher W. W. Norton & Company
Release Date 2021-02-02
Category Science
Total Pages 160
ISBN 9780393541168
Language English, Spanish, and French
GET BOOK
Book Summary:

The Nobel Prize–winning scientist’s elegant explanation of the fundamental ideas in biology and their uses today. The renowned biologist Paul Nurse has spent his career revealing how living cells work. In What Is Life?, he takes up the challenge of describing what it means to be alive in a way that every reader can understand. It is a shared journey of discovery; step-by-step Nurse illuminates five great ideas that underpin biology—the Cell, the Gene, Evolution by Natural Selection, Life as Chemistry, and Life as Information. He introduces the scientists who made the most important advances, and, using his personal experiences in and out of the lab, he shares with us the challenges, the lucky breaks, and the thrilling eureka moments of discovery. Nurse writes with delight at life’s richness and with a sense of the urgent role of biology in our time. To survive the challenges that face us all today—climate change, pandemic, loss of biodiversity and food security—it is vital that we all understand what life is.

A New History Of Life by Peter Ward

Title A New History of Life
Author Peter Ward
Publisher Bloomsbury Publishing USA
Release Date 2015-04-07
Category Science
Total Pages 400
ISBN 9781608199082
Language English, Spanish, and French
GET BOOK
Book Summary:

The history of life on Earth is, in some form or another, known to us all--or so we think. A New History of Life offers a provocative new account, based on the latest scientific research, of how life on our planet evolved--the first major new synthesis for general readers in two decades. Charles Darwin's theories, first published more than 150 years ago, form the backbone of how we understand the history of the Earth. In reality, the currently accepted history of life on Earth is so flawed, so out of date, that it's past time we need a 'New History of Life.' In their latest book, Joe Kirschvink and Peter Ward will show that many of our most cherished beliefs about the evolution of life are wrong. Gathering and analyzing years of discoveries and research not yet widely known to the public, A New History of Life proposes a different origin of species than the one Darwin proposed, one which includes eight-foot-long centipedes, a frozen “snowball Earth”, and the seeds for life originating on Mars. Drawing on their years of experience in paleontology, biology, chemistry, and astrobiology, experts Ward and Kirschvink paint a picture of the origins life on Earth that are at once too fabulous to imagine and too familiar to dismiss--and looking forward, A New History of Life brilliantly assembles insights from some of the latest scientific research to understand how life on Earth can and might evolve far into the future.

Life S Ratchet by Peter Hoffmann

Title Life s Ratchet
Author Peter Hoffmann
Publisher Basic Books
Release Date 2012-10-30
Category Science
Total Pages 288
ISBN 9780465033362
Language English, Spanish, and French
GET BOOK
Book Summary:

Below the calm, ordered exterior of a living organism lies microscopic chaos, or what the author calls the molecular storm--specialized molecules immersed in a whirlwind of colliding water molecules. Our cells are filled with molecular machines, which, like tiny ratchets, transform random motion into ordered activity, and create the "purpose" that is the hallmark of life. Tiny electrical motors turn electrical voltage into motion, nanoscale factories custom-build other molecular machines, and mechanical machines twist, untwist, separate and package strands of DNA. Life, the author argues, emerges from the random motions of atoms filtered through these sophisticated structures of our evolved machinery. The book is grounded in the author's own cutting-edge research.-Book Jacket.

Title Great Transformations in Vertebrate Evolution
Author Kenneth P. Dial
Publisher University of Chicago Press
Release Date 2015-07-20
Category Science
Total Pages 424
ISBN 9780226268392
Language English, Spanish, and French
GET BOOK
Book Summary:

How did flying birds evolve from running dinosaurs, terrestrial trotting tetrapods evolve from swimming fish, and whales return to swim in the sea? These are some of the great transformations in the 500-million-year history of vertebrate life. And with the aid of new techniques and approaches across a range of fields—work spanning multiple levels of biological organization from DNA sequences to organs and the physiology and ecology of whole organisms—we are now beginning to unravel the confounding evolutionary mysteries contained in the structure, genes, and fossil record of every living species. This book gathers a diverse team of renowned scientists to capture the excitement of these new discoveries in a collection that is both accessible to students and an important contribution to the future of its field. Marshaling a range of disciplines—from paleobiology to phylogenetics, developmental biology, ecology, and evolutionary biology—the contributors attack particular transformations in the head and neck, trunk, appendages such as fins and limbs, and the whole body, as well as offer synthetic perspectives. Illustrated throughout, Great Transformations in Vertebrate Evolution not only reveals the true origins of whales with legs, fish with elbows, wrists, and necks, and feathered dinosaurs, but also the relevance to our lives today of these extraordinary narratives of change.

Flying Dinosaurs by John Pickrell

Title Flying Dinosaurs
Author John Pickrell
Publisher NewSouth
Release Date 2014-06-01
Category Nature
Total Pages 256
ISBN 9781742241760
Language English, Spanish, and French
GET BOOK
Book Summary:

Dinosaurs didn’t die out when an asteroid hit Earth 66 million years ago. Get ready to unthink what you thought you knew and journey into the deep, dark depths of the Jurassic. The discovery of the first feathered dinosaur in China in 1996 sent shockwaves through the palaeontological world. Were the feathers part of a complex mating ritual, or a stepping stone in the evolution of flight? And just how closely related T. rex to a chicken Award-winning journalist John Pickrell reveals how dinosaurs developed flight and became the birds in our backyards. He delves into the latest discoveries in China, the US, Europe and uncovers a thriving black market in fossils and infighting between dinosaur hunters, plus the controversial plan to use a chicken to bring dinosaurs back from the dead.

Creation by Adam Rutherford

Title Creation
Author Adam Rutherford
Publisher Penguin UK
Release Date 2013-04-04
Category Science
Total Pages 272
ISBN 9780141970226
Language English, Spanish, and French
GET BOOK
Book Summary:

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Title Who We Are and How We Got Here
Author David Reich
Publisher Oxford University Press
Release Date 2018-03-27
Category DNA
Total Pages 368
ISBN 9780198821250
Language English, Spanish, and French
GET BOOK
Book Summary:

David Reich describes how the revolution in the ability to sequence ancient DNA has changed our understanding of the deep human past. This book tells the emerging story of our often surprising ancestry - the extraordinary ancient migrations and mixtures of populations that have made us who we are.

Title The Story of Evolution in 25 Discoveries
Author Donald R. Prothero
Publisher Columbia University Press
Release Date 2020-12-22
Category Science
Total Pages 360
ISBN 9780231548854
Language English, Spanish, and French
GET BOOK
Book Summary:

The theory of evolution unites the past, present, and future of living things. It puts humanity’s place in the universe into necessary perspective. Despite a history of controversy, the evidence for evolution continues to accumulate as a result of many separate strands of amazing scientific sleuthing. In The Story of Evolution in 25 Discoveries, Donald R. Prothero explores the most fascinating breakthroughs in piecing together the evidence for evolution. In twenty-five vignettes, he recounts the dramatic stories of the people who made crucial discoveries, placing each moment in the context of what it represented for the progress of science. He tackles topics like what it means to see evolution in action and what the many transitional fossils show us about evolution, following figures from Darwin to lesser-known researchers as they unlock the mysteries of the fossil record, the earth, and the universe. The book also features the stories of animal species strange and familiar, including humans—and our ties to some of our closest relatives and more distant cousins. Prothero’s wide-ranging tales showcase awe-inspiring and bizarre aspects of nature and the powerful insights they give us into the way that life works. Brisk and entertaining while firmly grounded in fundamental science, The Story of Evolution in 25 Discoveries is a captivating read for anyone curious about the evidence for evolution and what it means for humanity.

From Here To There by Michael Bond

Title From Here to There
Author Michael Bond
Publisher Harvard University Press
Release Date 2020-05-26
Category Science
Total Pages 272
ISBN 9780674247376
Language English, Spanish, and French
GET BOOK
Book Summary:

A wise and insightful exploration of human navigation, what it means to be lost, and how we find our way. How is it that we can walk unfamiliar streets while maintaining a sense of direction? Come up with shortcuts on the fly, in places we’ve never traveled? The answer is the complex mental map in our brains. This feature of our cognition is easily taken for granted, but it’s also critical to our species’ evolutionary success. In From Here to There Michael Bond tells stories of the lost and found—Polynesian sailors, orienteering champions, early aviators—and surveys the science of human navigation. Navigation skills are deeply embedded in our biology. The ability to find our way over large distances in prehistoric times gave Homo sapiens an advantage, allowing us to explore the farthest regions of the planet. Wayfinding also shaped vital cognitive functions outside the realm of navigation, including abstract thinking, imagination, and memory. Bond brings a reporter’s curiosity and nose for narrative to the latest research from psychologists, neuroscientists, animal behaviorists, and anthropologists. He also turns to the people who design and expertly maneuver the world we navigate: search-and-rescue volunteers, cartographers, ordnance mappers, urban planners, and more. The result is a global expedition that furthers our understanding of human orienting in the natural and built environments. A beguiling mix of storytelling and science, From Here to There covers the full spectrum of human navigation and spatial understanding. In an age of GPS and Google Maps, Bond urges us to exercise our evolved navigation skills and reap the surprising cognitive rewards.

Title The Origin and Nature of Life on Earth
Author Eric Smith
Publisher Cambridge University Press
Release Date 2016-04-30
Category Science
Total Pages 840
ISBN 9781107121881
Language English, Spanish, and French
GET BOOK
Book Summary:

Uniting the foundations of physics and biology, this groundbreaking multidisciplinary and integrative book explores life as a planetary process.

What Stars Are Made Of by Donovan Moore

Title What Stars Are Made Of
Author Donovan Moore
Publisher Unknown
Release Date 2020
Category Biography & Autobiography
Total Pages 304
ISBN 9780674237377
Language English, Spanish, and French
GET BOOK
Book Summary:

Cecilia Payne-Gaposchkin was the revolutionary scientific thinker who discovered what stars are made of. But her name is hard to find alongside those of Hubble, Herschel, and other great astronomers. Donovan Moore tells the story of Payne's life of determination against all the obstacles a patriarchal society erected against her.

The Wise Company by Ikujiro Nonaka

Title The Wise Company
Author Ikujiro Nonaka
Publisher Oxford University Press, USA
Release Date 2019-10
Category Business & Economics
Total Pages 304
ISBN 9780190497002
Language English, Spanish, and French
GET BOOK
Book Summary:

High-velocity change is the fundamental challenge facing companies today. Few companies, however, are prepared to continuously innovate-because they focus on the short-term and do not emphasize the wisdom needed to make sure that their interests are aligned with those of society. Practical wisdom is the bases of continuous innovation, where companies ceaselessly and repeatedly creating new knowledge, disseminating it throughout the organization, and converting knowledge to action over time. In The Wise Company, legendary management experts Ikujiro Nonaka and Hirotaka Takeuchi highlight how various companies have confronted the challenge of rapid change to create new products and new ways of doing business that benefit employees, consumers, and society. The key: a relentless self-renewal process where companies realize the future they envisions, rather than only responding to changes in the environment. Nonaka and Takeuchi argue that while knowledge-creating companies focusing on tacit and explicit knowledge can generate innovation, they cannot create it on a continuous and ongoing basis without having wisdom about human interactions and how they influence organizational structures and practices. Companies that have resilience, longevity, and sustainability share a number of characteristics, Nonaka and Takeuchi show. Strategies are based on alignment of organizational and societal benefits. Leaders grasp the core of any situation or problem quickly, and intuitively comprehend the nature and meaning of people, things, and events. But wise leadership is not enough: wisdom must infuse the organization through informal as well as formal shared interactions and communications that focus on metaphors and stories that convey the essence and meaning of strategies and actions. In short, Nonaka and Takeuchi demonstrate how continuous innovation results from companies ceaselessly and repeatedly creating new knowledge, disseminating knowledge throughout the organization, and converting that knowledge to action. The Wise Company presents a new model of knowledge-creation and practice for the twenty-first century.

LEAVE A COMMENT