Download An Astronaut S Guide To Life On Earth Ebook, Epub, Textbook, quickly and easily or read online An Astronaut S Guide To Life On Earth full books anytime and anywhere. Click download or read online button and get unlimited access by create free account.

Title An Astronaut s Guide to Life on Earth
Author Chris Hadfield
Publisher Little, Brown
Release Date 2013-10-29
Category Business & Economics
Total Pages 304
ISBN 0316253014
Language English, Spanish, and French
GET BOOK

Book Summary:

Colonel Chris Hadfield has spent decades training as an astronaut and has logged nearly 4000 hours in space. During this time he has broken into a Space Station with a Swiss army knife, disposed of a live snake while piloting a plane, and been temporarily blinded while clinging to the exterior of an orbiting spacecraft. The secret to Col. Hadfield's success-and survival-is an unconventional philosophy he learned at NASA: prepare for the worst-and enjoy every moment of it. In An Astronaut's Guide to Life on Earth, Col. Hadfield takes readers deep into his years of training and space exploration to show how to make the impossible possible. Through eye-opening, entertaining stories filled with the adrenaline of launch, the mesmerizing wonder of spacewalks, and the measured, calm responses mandated by crises, he explains how conventional wisdom can get in the way of achievement-and happiness. His own extraordinary education in space has taught him some counterintuitive lessons: don't visualize success, do care what others think, and always sweat the small stuff. You might never be able to build a robot, pilot a spacecraft, make a music video or perform basic surgery in zero gravity like Col. Hadfield. But his vivid and refreshing insights will teach you how to think like an astronaut, and will change, completely, the way you view life on Earth-especially your own.

Title An Astronaut s Guide to Life on Earth
Author Chris Hadfield
Publisher Little, Brown
Release Date 2013-10-29
Category Business & Economics
Total Pages 304
ISBN 9780316253048
Language English, Spanish, and French
GET BOOK

Book Summary:

Colonel Chris Hadfield has spent decades training as an astronaut and has logged nearly 4000 hours in space. During this time he has broken into a Space Station with a Swiss army knife, disposed of a live snake while piloting a plane, and been temporarily blinded while clinging to the exterior of an orbiting spacecraft. The secret to Col. Hadfield's success-and survival-is an unconventional philosophy he learned at NASA: prepare for the worst- and enjoy every moment of it. In An Astronaut's Guide to Life on Earth, Col. Hadfield takes readers deep into his years of training and space exploration to show how to make the impossible possible. Through eye-opening, entertaining stories filled with the adrenaline of launch, the mesmerizing wonder of spacewalks, and the measured, calm responses mandated by crises, he explains how conventional wisdom can get in the way of achievement-and happiness. His own extraordinary education in space has taught him some counterintuitive lessons: don't visualize success, do care what others think, and always sweat the small stuff. You might never be able to build a robot, pilot a spacecraft, make a music video or perform basic surgery in zero gravity like Col. Hadfield. But his vivid and refreshing insights will teach you how to think like an astronaut, and will change, completely, the way you view life on Earth-especially your own.

Title An Astronaut s Guide to Life on Earth
Author Chris Hadfield
Publisher Unknown
Release Date 2013
Category Science
Total Pages 336
ISBN 1447257510
Language English, Spanish, and French
GET BOOK

Book Summary:

Colonel Chris Hadfield has spent decades training as an astronaut and has logged nearly 4,000 hours in space. During this time he has broken into a Space Station with a Swiss army knife, disposed of a live snake while piloting a plane, and been temporarily blinded while clinging to the exterior of an orbiting spacecraft. The secret to Col. Hadfield's success - and survival - is an unconventional philosophy he learned at NASA: prepare for the worst - and enjoy every moment of it. In An Astronaut's Guide to Life on Earth, Col. Hadfield takes readers deep into his years of training and space exploration to show how to make the impossible possible. Through eye-opening, entertaining stories filled with the adrenaline of launch, the mesmerizing wonder of spacewalks and the measured, calm responses mandated by crises, he explains how conventional wisdom can get in the way of achievement - and happiness. His own extraordinary education in space has taught him some counterintuitive lessons: don't visualize success, do care what others think, and always sweat the small stuff. You might never be able to build a robot, pilot a spacecraft, make a music video or perform basic surgery in zero gravity like Col. Hadfield. But his vivid and refreshing insights will teach you how to think like an astronaut, and will change, completely, the way you view life on Earth - especially your own.

How To Astronaut by Terry Virts

Title How to Astronaut
Author Terry Virts
Publisher Workman Publishing
Release Date 2020-09-15
Category Science
Total Pages 320
ISBN 9781523512041
Language English, Spanish, and French
GET BOOK

Book Summary:

"There's something intriguing to be learned on practically every page... [How to Astronaut] captures the details of an extraordinary job and turns even the mundane aspects of space travel into something fascinating."––Publishers Weekly Ride shotgun on a trip to space with astronaut Terry Virts. A born stroyteller with a gift for the surprising turn of phrase and eye for the perfect you-are-there details, he captures all the highs, lows, humor, and wonder of an experience few will ever know firsthand. Featuring stories covering survival training, space shuttle emergencies, bad bosses, the art of putting on a spacesuit, time travel, and much more!

You Are Here by Chris Hadfield

Title You Are Here
Author Chris Hadfield
Publisher Pan Macmillan
Release Date 2014-10-14
Category Photography
Total Pages 86
ISBN 9781447278610
Language English, Spanish, and French
GET BOOK

Book Summary:

In You Are Here, celebrated astronaut Chris Hadfield gives us the really big picture: this is our home, as seen from space. The millions of us who followed Hadfield's news-making Twitter feed from the International Space Station thought we knew what we were looking at when we first saw his photos. But we may have caught the beauty and missed the full meaning. Now, through photographs – many of which have never been shared – Hadfield unveils a fresh and insightful look at our planet. He sees astonishing detail and importance in these images, not just because he's spent months in space but because his in-depth knowledge of geology, geography and meteorology allows him to reveal the photos' mysteries. Featuring Hadfield's favourite images, You Are Here is divided by continent and represents one (idealized) orbit of the ISS. Surprising, thought-provoking and visually delightful, it opens a singular window on our planet, using remarkable photographs to illuminate the history and consequences of human settlement, the magnificence of never-before-noticed landscapes, and the power of the natural forces shaping our world and the future of our species.

Ask An Astronaut by Tim Peake

Title Ask an Astronaut
Author Tim Peake
Publisher Little, Brown
Release Date 2017-10-17
Category Biography & Autobiography
Total Pages 8
ISBN 9780316512800
Language English, Spanish, and French
GET BOOK

Book Summary:

Was it fun to do a space walk? How squashed were you in the capsule on the way back? What were your feelings as you looked down on Earth for the first time? Were you ever scared? Where to next -- the Moon, Mars, or beyond? Based on his historic mission to the International Space Station, Ask an Astronaut is Tim Peake's guide to life in space, and his answers to the thousands of questions he has been asked since his return to Earth. With explanations ranging from the mundane -- how do you wash your clothes or go to the bathroom while in orbit? -- to the profound -- what's the point? -- all written in Tim's characteristically warm style, Tim shares his thoughts on every aspect of space exploration. From training for the mission to launch, to his historic spacewalk, to re-entry, he reveals for readers of all ages the cutting-edge science behind his groundbreaking experiments, and the wonders of daily life on board the International Space Station. The public was invited to submit questions using the hashtag #askanastronaut, and a selection are answered by Tim in the book, accompanied with illustrations, diagrams, and never-before-seen photos.

The Darkest Dark by Chris Hadfield

Title The Darkest Dark
Author Chris Hadfield
Publisher Tundra Books
Release Date 2016-09-10
Category Juvenile Fiction
Total Pages 40
ISBN 9781101918647
Language English, Spanish, and French
GET BOOK

Book Summary:

Inspired by the childhood of real-life astronaut Chris Hadfield and brought to life by Terry and Eric Fan's lush, evocative illustrations, The Darkest Dark will encourage readers to dream the impossible. Chris loves rockets and planets and pretending he's a brave astronaut, exploring the universe. Only one problem--at night, Chris doesn't feel so brave. He's afraid of the dark. But when he watches the groundbreaking moon landing on TV, he realizes that space is the darkest dark there is--and the dark is beautiful and exciting, especially when you have big dreams to keep you company.

Spaceman by Mike Massimino

Title Spaceman
Author Mike Massimino
Publisher Crown Archetype
Release Date 2016-10-04
Category Biography & Autobiography
Total Pages 336
ISBN 9781101903551
Language English, Spanish, and French
GET BOOK

Book Summary:

NEW YORK TIMES BESTSELLER • Have you ever wondered what it would be like to find yourself strapped to a giant rocket that’s about to go from zero to 17,500 miles per hour? Or to look back on Earth from outer space and see the surprisingly precise line between day and night? Or to stand in front of the Hubble Space Telescope, wondering if the emergency repair you’re about to make will inadvertently ruin humankind’s chance to unlock the universe’s secrets? Mike Massimino has been there, and in Spaceman he puts you inside the suit, with all the zip and buoyancy of life in microgravity. Massimino’s childhood space dreams were born the day Neil Armstrong set foot on the moon. Growing up in a working-class Long Island family, he catapulted himself to Columbia and then MIT, only to flunk his first doctoral exam and be rejected three times by NASA before making it through the final round of astronaut selection. Taking us through the surreal wonder and beauty of his first spacewalk, the tragedy of losing friends in the Columbia shuttle accident, and the development of his enduring love for the Hubble Telescope—which he and his fellow astronauts were tasked with saving on his final mission—Massimino has written an ode to never giving up and the power of teamwork to make anything possible. Spaceman invites us into a rare, wonderful world where science meets the most thrilling adventure, revealing just what having “the right stuff” really means.

Title An Earthling s Guide to Outer Space
Author Bob McDonald
Publisher Simon and Schuster
Release Date 2019-10-22
Category Science
Total Pages 240
ISBN 9781982106867
Language English, Spanish, and French
GET BOOK

Book Summary:

Beloved science commentator Bob McDonald takes us on a tour of our galaxy, unraveling the mysteries of the universe and helping us navigate our place among the stars. How big is our galaxy? Is there life on those distant planets? Are we really made of star dust? And where do stars even come from? In An Earthling’s Guide to Outer Space, we finally have the answers to all those questions and more. With clarity, wisdom, and a great deal of enthusiasm, McDonald explores the curiosities of the big blue planet we call home as well as our galactic neighbours—from Martian caves to storm clouds on Jupiter to the nebulae at the far end of the universe. So if you’re pondering how to become an astronaut, or what dark matter really is, or how an asteroid wiped out the dinosaurs, look no further. Through a captivating mix of stories, experiments, and illustrations, McDonald walks us through space exploration past and present, and reveals what we can look forward to in the future. An Earthling’s Guide to Outer Space is sure to satisfy science readers of all ages, and to remind us earthbound terrestrials just how special our place in the universe truly is.

Endurance by Scott Kelly

Title Endurance
Author Scott Kelly
Publisher Vintage
Release Date 2017-10-17
Category Biography & Autobiography
Total Pages 400
ISBN 9781524731601
Language English, Spanish, and French
GET BOOK

Book Summary:

NATIONAL BEST SELLER A stunning, personal memoir from the astronaut and modern-day hero who spent a record-breaking year aboard the International Space Station—a message of hope for the future that will inspire for generations to come. The veteran of four spaceflights and the American record holder for consecutive days spent in space, Scott Kelly has experienced things very few have. Now, he takes us inside a sphere utterly hostile to human life. He describes navigating the extreme challenge of long-term spaceflight, both life-threatening and mundane: the devastating effects on the body; the isolation from everyone he loves and the comforts of Earth; the catastrophic risks of colliding with space junk; and the still more haunting threat of being unable to help should tragedy strike at home--an agonizing situation Kelly faced when, on a previous mission, his twin brother's wife, American Congresswoman Gabrielle Giffords, was shot while he still had two months in space. Kelly's humanity, compassion, humor, and determination resonate throughout, as he recalls his rough-and-tumble New Jersey childhood and the youthful inspiration that sparked his astounding career, and as he makes clear his belief that Mars will be the next, ultimately challenging, step in spaceflight. In Endurance, we see the triumph of the human imagination, the strength of the human will, and the infinite wonder of the galaxy.

Defying Limits by Dave Williams

Title Defying Limits
Author Dave Williams
Publisher Simon & Schuster
Release Date 2019-10-01
Category Biography & Autobiography
Total Pages 240
ISBN 9781501160974
Language English, Spanish, and French
GET BOOK

Book Summary:

INSTANT NATIONAL BESTSELLER An inspirational, uplifting, and life-affirming memoir about passion, resilience, and living life to the fullest, from Dr. Dave Williams, one of Canada’s most accomplished astronauts. I had dreamt about becoming an astronaut from the time I watched Alan Shepard launch on the first American sub-orbital flight on May 5, 1961. Eleven days before my seventh birthday, I committed to a new goal: one day, I would fly in outer space. Dr. Dave has led the sort of life that most people only dream of. He has set records for spacewalking. He has lived undersea for weeks at a time. He has saved lives as an emergency doctor, launched into the stratosphere twice, and performed surgery in zero gravity. But if you ask him how he became so accomplished, he’ll say: “I’m just a curious kid from Saskatchewan.” Curious indeed. Dr. Dave never lost his desire to explore nor his fascination with the world. Whether he was exploring the woods behind his childhood home or floating in space at the end of the Canadarm, Dave tried to see every moment of his life as filled with beauty and meaning. He learned to scuba dive at only twelve years old, became a doctor despite academic struggles as an undergraduate, and overcame stiff odds and fierce competition to join the ranks of the astronauts he had idolized as a child. There were setbacks and challenges along the way—the loss of friends in the Columbia disaster, a cancer diagnosis that nearly prevented him from returning to space—but through it all, Dave never lost sight of his goal. And when he finally had the chance to fly among the stars, he came to realize that although the destination can be spectacular, it’s the journey that truly matters. In Defying Limits, Dave shares the events that have defined his life, showing us that whether we’re gravity-defying astronauts or earth-bound terrestrials, we can all live an infinite, fulfilled life by relishing the value and importance of each moment. The greatest fear that we all face is not the fear of dying, but the fear of never having lived. Each of us is greater than we believe. And, together, we can exceed our limits to soar farther and higher than we ever imagined.

Life On Earth And Beyond by Pamela S. Turner

Title Life on Earth and Beyond
Author Pamela S. Turner
Publisher Charlesbridge Publishing
Release Date 2008
Category Juvenile Nonfiction
Total Pages 109
ISBN 9781580891332
Language English, Spanish, and French
GET BOOK

Book Summary:

Invites readers to join NASA astrobiologist Dr. Chris McKay on a fascinating quest to better understand what factors are necessary to sustain life on both Earth and beyond. Simultaneous.

The Right Stuff by Tom Wolfe

Title The Right Stuff
Author Tom Wolfe
Publisher Farrar, Straus and Giroux
Release Date 2008-03-04
Category History
Total Pages 448
ISBN 1429961325
Language English, Spanish, and French
GET BOOK

Book Summary:

From "America's nerviest journalist" (Newsweek)--a breath-taking epic, a magnificent adventure story, and an investigation into the true heroism and courage of the first Americans to conquer space. "Tom Wolfe at his very best" (The New York Times Book Review) Millions of words have poured forth about man's trip to the moon, but until now few people have had a sense of the most engrossing side of the adventure; namely, what went on in the minds of the astronauts themselves - in space, on the moon, and even during certain odysseys on earth. It is this, the inner life of the astronauts, that Tom Wolfe describes with his almost uncanny empathetic powers, that made The Right Stuff a classic.

Title Not Necessarily Rocket Science
Author Kellie Gerardi
Publisher Mango Media Inc.
Release Date 2020-11-24
Category Science
Total Pages 189
ISBN 9781642504118
Language English, Spanish, and French
GET BOOK

Book Summary:

Follow one woman’s non-traditional path in the space industry as she guides and encourages anyone who has ever dreamed about life in outer space. In this candid science memoir and career guide, aerospace science professional Kellie Gerardi offers an inside look into the industry beginning to eclipse Silicon Valley. Whether you have a space science degree or are looking to learn about stars and the solar system, Not Necessarily Rocket Science proves there’s room for anyone who is passionate about exploration. With a space background and a mission to democratize access to space, this female astronaut candidate offers a front row seat to the final frontier. From her adventures training for Mars to testing spacesuits in microgravity, this unique handbook provides inspiration and guidance for aspiring astronauts everywhere. Look inside for answers to questions like: Will there be beer on Mars? Why do I need to do one-handed pushups in microgravity? How can I possibly lose a fortune in outer space? Praise for Not Necessarily Rocket Science “Blasts readers onto a rocket-fueled journey through space and time, the perfect primer for the next space age.” ?Zara Stone, author of The Future of Science is Female “Kellie is probably one of the best ambassadors for spaceflight in the 21st century that the industry could have.” ?Lucy Hawking, author of George’s Secret Key to the Universe and host of Audible’s Lucy in the Sky. “Unique and compelling . . . will appeal to anyone whose dreams are larger than the limitations others try to wrap them in. Gerardi is informed, inspiring, and full of humanity, as she takes readers on a personal journey into what it means to be a fully signed-up member of the space age. A must-read for space-dreamers everywhere!” ?Andrew Maynard, Author of Future Rising “Space may seem like a pretty intimidating place, open only to fighter pilots or brilliant engineers. But if humans are to ever settle worlds beyond Earth, it will take all kinds to make a society. That's where Not Necessarily Rocket Science comes in?a book that makes space accessible and fun, while showing readers where the front door is . . . . Kellie Gerardi deftly offers a sampling of the possible careers in space while helping those who are intrigued find their own pathway. Space needs more engineers, sure. But as Gerardi ably writes, it needs poets too.” ?Eric Berger, senior space editor at Ars Technica

Brilliant Blunders by Mario Livio

Title Brilliant Blunders
Author Mario Livio
Publisher Simon and Schuster
Release Date 2014-05-27
Category Biography & Autobiography
Total Pages 352
ISBN 9781439192375
Language English, Spanish, and French
GET BOOK

Book Summary:

We all make mistakes. Nobody is perfect. And that includes five of the greatest scientists in history -- Charles Darwin, William Thomson (Lord Kelvin), Linus Pauling, Fred Hoyle, Albert Einstein. But the mistakes that these great scientists made helped science to advance. Indeed, as Mario Livio explains in this fascinating book, science thrives on error; it advances when erroneous ideas are disproven. All five scientists were great geniuses and fascinating human beings. Their blunders were part of their genius and part of the scientific process. Livio brilliantly analyses their errors to show where they were wrong and right, but what makes his book so enjoyable to read is Livio's analysis of the psychology of these towering figures. Along the way the reader learns an enormous amount about the evolution of life on earth and in the universe, but from an unusual vantage point -- the mistakes of great scientists rather than the achievements that made them famous.

Title So You Want to Be an Astronaut
Author Alyssa Carson
Publisher Unknown
Release Date 2018-11-28
Category
Total Pages 44
ISBN 173135794X
Language English, Spanish, and French
GET BOOK

Book Summary:

A realistic guide to becoming an Astronaut at a young age.

Title Packing for Mars The Curious Science of Life in the Void
Author Mary Roach
Publisher W. W. Norton & Company
Release Date 2011-04-04
Category Science
Total Pages 288
ISBN 0393079104
Language English, Spanish, and French
GET BOOK

Book Summary:

“America’s funniest science writer” (Washington Post) explores the irresistibly strange universe of life without gravity in this New York Times bestseller. The best-selling author of Stiff and Bonk explores the irresistibly strange universe of space travel and life without gravity. From the Space Shuttle training toilet to a crash test of NASA’s new space capsule, Mary Roach takes us on the surreally entertaining trip into the science of life in space and space on Earth.

Astronauts Zoom by Deborah Rose

Title Astronauts Zoom
Author Deborah Rose
Publisher Persnickety Press
Release Date 2020-09-05
Category
Total Pages 36
ISBN 1943978506
Language English, Spanish, and French
GET BOOK

Book Summary:

Zoom around Earth from A to Z with astronauts on the International Space Station in Astronauts Zoom! "You are there" photos and fun, fact-filled text give young readers and listeners a space-eye view of astronauts in action in this out-of-this-world alphabet book.

Creation by Adam Rutherford

Title Creation
Author Adam Rutherford
Publisher Penguin UK
Release Date 2013-04-04
Category Science
Total Pages 272
ISBN 9780141970226
Language English, Spanish, and French
GET BOOK

Book Summary:

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Title Chris Hadfield and Living on the International Space Station
Author Andrew Langley
Publisher Capstone
Release Date 2015-08
Category Juvenile Nonfiction
Total Pages 48
ISBN 9781484625224
Language English, Spanish, and French
GET BOOK

Book Summary:

Join Chris Hadfield living on the International Space Station! This book examines the extraordinary life of one of the most popular astronauts, from his early life to the six months he spent living in space. Discover what the International Space Centre is used for, and how astronauts like Hadfield can live there. Find out about the rigorous training that astronauts undergo and how they prepare for a journey into the unknown.